Chst10 antibody thermo
WebCHST10, Rabbit, Monoclonal Antibody, Abnova™-Rabbit monoclonal antibody raised against a human CHST10 peptide using ARM Technology. Fisher Scientific Fisher Healthcare WebCompare Anti-CHST10 Immunohistochemistry Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
Chst10 antibody thermo
Did you know?
WebAntibodies that detect CD16/CD32 can be used in several scientific applications, including Flow Cytometry, ELISA, Functional assay, Immunohistochemistry and Immunoprecipitation. These antibodies target CD16/CD32 in Mouse and Rhesus Monkey samples. Our CD16/CD32 monoclonal, polyclonal and recombinant monoclonal antibodies are … WebCHST10 Antibody (PA5-106630) in ICC/IF. Immunofluorescent analysis of CHST10 in HUVEC cell lysate. Samples were fixed with paraformaldehyde, permeabilized with 0.1% …
WebCarbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR): Novus Biologicals View Rabbit Polyclonal anti-Carbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR). Validated Applications: IHC, IHC-P. Validated Species: Human. Skip to main content Support: 1-888-506-6887 Items in Cart (0) [X] … WebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG ... Conjugate Unconjugated Immunogen A synthesized peptide derived from human CHST10, corresponding to a region within the internal amino acids. Form Liquid Concentration 1mg/mL Purification Affinity …
WebRabbit polyclonal antibody raised against synthetic peptide of CHST10.IgGy Antibody Selector – Quickly search hundreds of thousands of antibodies available for … WebIHC-P analysis of human lung carcinoma tissue using GTX87551 CHST10 antibody. The picture on the right is blocked with the synthesized peptide. GTX87551 WB Image WB analysis of HUVEC cell lysates using …
WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, …
WebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. arup k. senguptaWebA superior strategy for validation of antibody: Blocking peptide validation; Independent Antibody Verification; phospho-antibody made by Affinity; Fruit fly studies guide investigators to misregulated mechanism in human cancers; G Protein-Coupled Receptors (GPCRs) win 2012 Nobel Prize in Chemistry bang chu kanjiWebBuy rabbit polyclonal antibody to CHST10 (A37117). Validated Applications: WB and IHC. Tested Reactivity: Human. ️ Low Prices ️ 100% Guarantee arup k chatterjeeWebAntibodies. Protein structure ... CHST10 is part of cluster 22 Rhabdoid cancers - Neuronal signaling with confidence i 1 291 genes in cluster Go to interactive expression cluster page. 15 nearest neighbours based on cell line RNA expression. Neighbour i. Description i. ... bang chu cai tieng nhat hiragana va katakanaWebImmunohistochemical analysis of paraffin-embedded human gliomas using 12013-1-AP (CHST10 antibody) at dilution of 1:50 (under 10x lens). View All Images (2) Save time and replace your secondary antibodies with our FlexAble Antibody Labeling Kits $389 / 150 μL Cat No. 12013-1-AP In stock. bang chu cai katakana tieng nhatWebAnti-CHST10 Antibody Products from Thermo Fisher Scientific. Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate sulfotransferase 10' in humans and may also be known as HNK1ST, HNK-1ST, HNK-1 sulfotransferase, and huHNK-1ST. Structurally, the protein is reported to be 42.2 … arup kit d816vWebType Antibody Immunogen A synthetic peptide derived from the internal region of human CHST10 Conjugate Unconjugated Form Liquid Concentration 1mg/ml Purification … bang clustering